Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line
Main Article Content
Abstract
Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, some significant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.
Article Details
Keywords
Waxy gene, BGIOSGA022241, amylose content, BLASTN, DNA marker development
References
[2] P. D. Larkin and W. D. Park, “Association of Waxy gene single nucleotit polymorphisms with starch characteristics in rice (Oryza sativa L.)”. Molecular Breeding, 12 (4), 335–339, 2003.
[3] M. Nakagahara and T. Nagamine, “Spontaneous occurrence of low amylose genes and geographical distribution of amylose content in Asian rice”. Rice Genetics Newsletter, 3, 46-48, 1986.
[4] L. Liu, X. Ma, S. Liu, C. Zhu, L. Jiang, Y. Wang, Y. Shen, Y. Ren, H. Dong, L. Chen, X. Liu, Z. Zhao, H. Zhai, J. Wan, “Identification and characterization of a novel Waxy allele from Yunnan rice landrace”. Plant Molecular Biology, 71, 609–626, 2009.
[5] Kharabian Ardashir Masouleh, Daniel L. E. Waters, Russell F. Reinke, Rachelle Ward & Robert J. Henry, ”SNP in starch biosynthesis genes associated with nutritional and functional properties of rice”. Scientific Reports, 2, Article number: 557, 2012.
[6] M. H. Chen, C. J. Bergman, S. R. M. Pinson, R. G. Fjellstrom, “Waxy gene haplotypes: Associations with apparent amylose content and the effect by the environment in an international rice germplasm collection”. Journal of Cereal Science, 47(3), 536-545, 2008.
[7] Cheng Zai Quan, Liu Yan Ping, Chen Rui, Peng Bo, Xiong Hua Bin, Zhang Cheng, Zhong Qiao Fang and Huang Xing Qi, “Diversity of Waxy gene alleles in the wild rice species of the Oryza genus”. Botanical Studies,51, 403-411, 2010.
[8] H. Y. Hirano, Y. Sano, “Molecular Characterization of the Waxy Locus of Rice (Oryza sativa)”. Plant and Cell Physiology, 32 (7), 989-997, 1991.
[9] I. Mikami, N. Uwatoko, Y. Ikeda, J. Yamaguchi, H. Y. Hirano, Y. Suzuki and Y. Sano, “Allelic diversification at the Wx locus in landraces of Asian rice”. Theoretical and Applied Genetics, 116 (7), 979–89, 2008
[10] M. Isshiki, K. Morino, M. Nakajima, R. J. Okagaki, S. R. Wessler, T. Izawa and K. Shimamoto, “A naturally occurring functional allele of the rice Waxy locus has a GT to TT mutation at the 5′ splice site of the first intron”. The Plant Journal, 15 (1), 133–138, 1998.
[11] Y. Sano, “Differential regulation of Waxy gene expression in rice endosperm”. Theoretical and Applied Genetics, 68 (5), 467-473, 1985.
[12] X. L. Cai, Z. Y. Wang, Y. Y. Xing, J. L. Zhang, M. M. Hong, “Aberrant splicing of intron 1 leads to the heterogeneous 5' UTR and decreased expression of Waxy gene in rice cultivars of intermediate amylose content”. The Plant Journal, 14(4), 459-465, 1998.
[13] Z. Y. Wang, F. Q. Zheng, G. Z. Shen, J. P. Gao, D. P. Snustad, M. G. Li, J. L. Zhang, M. M. Hong, “The amylose content in rice endosperm is related to the post-transcriptional regulation of the Waxy gene”. The Plant Journal, 7(4), 613-622, 1995.
[14] M. Dobo, N. Ayres, G. Walker, W. D. Park, “Polymorphism in the GBSS gene affects amylose content in US and European rice germplasm”. Journal Cereal Science, 52(3), 450–456, 2010.
[15] N. M. Ayres, A. M. Mc Clung, P. D. Larkin, H. F. J. Bligh, C. A. Jones, W. D. Park, “Microsatellites and a single-nucleotit polymorphism differentiate apparent amylase classes in an extended pedigree of US rice germplasm”. Theoretical and Applied Genetics, 94, 773–781, 1997.
[16] C. Biselli, D. Cavalluzzo, R. Perrini, A. Gianinetti, P. Bagnaresi, S. Urso, G. Orasen, F. Desiderio, E. Lupotto, L. Cattivelli, “Improvement of marker-based predictability of Apparent Amylose Content in japonica rice through GBSSI allele mining”. Rice, 7 (1), 2014.
[17] P. D. Larkin and W. D. Park, “Transcript accumulation and utilization of alternate and non-consensus splice sites in rice granule-bound starch synthase are temperature-sensitive and controlled by a single-nucleotit polymorphism”. Plant Molecular Biology, 40 (4), 719–727, 1999.
[18] Tran Thi Thu Hoai, Hiroaki Matsusaka, Yoshiko Toyosawa, Tran Danh Suu, Hikaru Satoh and Toshihiro Kumamaru, “Influence of single-nucleotit polymorphisms in the gene encoding granule-bound starch synthase I on amylose content in Vietnamese rice cultivars”. Breeding science, 64(2), 142–148, 2014.
[19] A. Kharabian, “An efficient computational method for screening functional SNPs in plants”. Journal of Theoretical Biology, 265, 55–6, 2010.
[20] H. Sato, Y. Suzuki, M. Sakai, T. Imbe, “Molecular characterization of Wx-mq, anovel mutant gene for low-amylose content in endosperm of rice (Oryza sativa L.)”. Breeding Science, 52, 131–135, 2002.
[21] J. S. Bao, H. Corke, M. Sun, “Nucleotit diversity in starch synthase IIa and validation of single nucleotit polymorphisms in relation to starch gelatinization temperature and other physicochemical properties in rice (Oryza sativa L.)”. Theoretical and Applied Genetics, 113, 1171–1183, 2006.
[22] T. T. Hoai, A. Nishi and H. Satoh, “Diversity of granule bound starch synthesis (GBSS)
levels in North Vietnam local rice cultivars”. Rice Genetics Newsletter, 24, 62–64, 2008.
[23] M. S. Jahan, T. Kumamaru, A. Hamid and H. Satoh, “Diversity of granule bound starch synthase (GBSS) level in Bangladesh rice cultivars”. Rice Genetics Newsletter, 19, 69–71, 2002.
[24] H. Satoh, R. X. Ronald and T. C. Katayama, “On amylose content of cultivated rice collected in Madagasca, Kagoshima University Research Center South Pacific”, Occasional Papers, 18, 83–91, 1990
[25] https://www.qiagen.com
[26] http://www.gramene.org